IV. Lab Protocol for ISSR seq - barrettlab/2021-Genomics-bootcamp GitHub Wiki
Detailed ISSR-seq Protocol
1. Preliminary panel to test ISSR PCR Amplification
1a. Isolated genomic DNA was diluted to 20ng/ul before proceeding. This can be checked with nanodrop, but preferably using Qubit fluorometry.
1b. First, test multiple primer motifs (from the University of British Columbia (Pharmawati et al. 2005)) on selected samples to determine which should be used for amplification.
A list of primer motifs we typically use (non-exhaustive, you can design your own!):
| ISSR primer | Motif |
|---|---|
| anchored | motifs |
| 813 | (CT)8T |
| 814 | (CT)8A |
| 815 | (CT)8G |
| 817 | (CA)8A |
| 820 | (GT)8T |
| 824 | (TC)8G |
| 826 | (AC)8C |
| 834 | (AG)8YT |
| 836 | (AG)8YA |
| 840 | (GA)8YT |
| 843 | (CT)8RA |
| 845 | (CT)8RG |
| 848 | (CA)8RG |
| 855 | (AC)8YT |
| 856 | (AC)8YA |
| 857 | (AC)8YG |
| 858 | (AC)8RT |
| 859 | (TG)8RC |
| 860 | (TG)8RA |
| unanchored | motifs |
| 868 | (GAA)6 |
| 873 | (GACA)4 |
| caa5 | (CAA)5 |
| cag5 | (CAG)5 |
| gtt5 | (GTT)5 |
| gat5 | (GAT)5 |
| cat5 | (CAT)5 |
1c. Choose 2-4 accessions from different populations as a panel to test all primers. ** ALWAYS** run a negative control, and a positive if you have previous samples that worked well.
1d. The PCR reaction and conditions are below.
ISSR PCR Reaction:
10ul reactions:
| Volume | Reagent |
|---|---|
| 5 ul | 2 x PCR Master Mix |
| 2.5 ul | H20 |
| 1 ul | Single ISSR primer |
| 0.5 ul | Betaine |
| 1 ul | DNA (diluted to 20ng/ul) |
Thermocycler Conditions:
| Temperature | Time |
|---|---|
| 95°C | 4 min |
| 94°C | 30 sec |
| 50°C | 45 sec x 30 cycles |
| 72°C | 2 min |
| 72°C | 10 min |
| 4°C | hold |
1e. After amplification, all products should be run on a 1% agarose gel to visualize banding.
1f. Successful ISSR amplification will have multiple bands with sizes varying from a few kb to as low as 200 base pairs. If using herbarium samples, the larger bands will tend to drop out.
1g. Once gel(s) have been run, determine which primers worked across all 2-4 samples used for testing, as these should be used for the rest of the experiment.
Optional: You may want to try multiple primers in a single reaction as well, as long as they don’t form strong dimers (e.g. ACACACACACACYT + TGTGTGTGTGTGYA).
2. Overview of Full-Project ISSR PCR Amplification
2a. PCR. Using the ISSR primers that were chosen from the panel study, a PCR will need to be run for each sample with each primer. This can easily be set up with a single 96-well plate. (e.g. 1 sample x 8 primers = 8 PCRs; 96 samples x 8 primers = 8 individual PCR plates, e.g. one plate per primer master mix).
2b. Gel. After PCR, products can be run on an a 1% agarose gel to show amplification.
2c. The ISSR bands on the gel can be scored and used as dominant presence-absence data, however, that is not necessary for this protocol.
Caveat: running 8 x 96 individual amplicons on a gel can be exhaustive and wasteful. Instead, we suggest running a gel on the pooled amplicons for each sample from many primers (below).
2d. Pooling amplicons. Following PCR and gels, PCR products from each sample are pooled to have one pool per sample containing all products. So if you used 8 primers in 10 ul reactions for each sample, then you will have 80 ul for each sample’s pool.
2e. Cleanup. Pooled samples should be cleaned with a 1:1 bead cleanup to remove impurities, followed by two 80% ethanol washes. We use Axygen AxyPrep Fragment Select beads. Another (more common) option is Ampure XP beads. To save $$$, you could also use a "homebrew" option for beads: Homebrew beads
2f. Use the Qubit BR assay to determine DNA concentration.
2g. Pools should be diluted to 5ng/ul to prepare for library preparation.
3. Overview of Library Preparation of ISSR products
Library preparations can be made with preferred kits. Some examples are below: NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina We use: sparQ DNA Frag & Library Prep Kit
3a. We used the Quantabio sparQ DNA Frag & Library Prep Kit and reduced the reaction size from 50ul to 20ul. This kit uses a fragmentase in place of sonication, and is very efficient.
iTru7 (forward barcoded primers)
| barcode | primer_name | full_sequence |
|---|---|---|
| GGTAACGT | iTru7_101_01 | CAAGCAGAAGACGGCATACGAGATGGTAACGTGTGACTGGAGTTCA*G |
| CAACACAG | iTru7_101_02 | CAAGCAGAAGACGGCATACGAGATCAACACAGGTGACTGGAGTTCA*G |
| ACACCTCA | iTru7_101_03 | CAAGCAGAAGACGGCATACGAGATACACCTCAGTGACTGGAGTTCA*G |
| CATGGATC | iTru7_101_04 | CAAGCAGAAGACGGCATACGAGATCATGGATCGTGACTGGAGTTCA*G |
| TGATAGGC | iTru7_101_05 | CAAGCAGAAGACGGCATACGAGATTGATAGGCGTGACTGGAGTTCA*G |
| CGGTTGTT | iTru7_101_06 | CAAGCAGAAGACGGCATACGAGATCGGTTGTTGTGACTGGAGTTCA*G |
| CAACGAGT | iTru7_101_07 | CAAGCAGAAGACGGCATACGAGATCAACGAGTGTGACTGGAGTTCA*G |
| ACCATAGG | iTru7_101_08 | CAAGCAGAAGACGGCATACGAGATACCATAGGGTGACTGGAGTTCA*G |
| GGTGTACA | iTru7_101_09 | CAAGCAGAAGACGGCATACGAGATGGTGTACAGTGACTGGAGTTCA*G |
| CAGCATAC | iTru7_101_10 | CAAGCAGAAGACGGCATACGAGATCAGCATACGTGACTGGAGTTCA*G |
| GGACATCA | iTru7_101_11 | CAAGCAGAAGACGGCATACGAGATGGACATCAGTGACTGGAGTTCA*G |
| AGAAGGAC | iTru7_101_12 | CAAGCAGAAGACGGCATACGAGATAGAAGGACGTGACTGGAGTTCA*G |
iTru5 (reverse barcoded primers)
| barcode | primer_name | full_sequence |
|---|---|---|
| ACCGACAA | iTru5_01_A | AATGATACGGCGACCACCGAGATCTACACACCGACAAACACTCTTTCCCTA*C |
| AGTGGCAA | iTru5_01_B | AATGATACGGCGACCACCGAGATCTACACAGTGGCAAACACTCTTTCCCTA*C |
| CACAGACT | iTru5_01_C | AATGATACGGCGACCACCGAGATCTACACCACAGACTACACTCTTTCCCTA*C |
| CGACACTT | iTru5_01_D | AATGATACGGCGACCACCGAGATCTACACCGACACTTACACTCTTTCCCTA*C |
| GACTTGTG | iTru5_01_E | AATGATACGGCGACCACCGAGATCTACACGACTTGTGACACTCTTTCCCTA*C |
| GTGAGACT | iTru5_01_F | AATGATACGGCGACCACCGAGATCTACACGTGAGACTACACTCTTTCCCTA*C |
| GTTCCATG | iTru5_01_G | AATGATACGGCGACCACCGAGATCTACACGTTCCATGACACTCTTTCCCTA*C |
| TAGCTGAG | iTru5_01_H | AATGATACGGCGACCACCGAGATCTACACTAGCTGAGACACTCTTTCCCTA*C |
3b. Fragmentation time. The optimal time for fragmentation was 3.5 minutes for our pooled ISSR amplicon samples to have product between the target range of 300-500 bp.
However, that time may vary depending on conditions, specifically the size distribution of your amplicons. A test should be run using a couple of samples to determine if 3.5 minutes results in the desired size and, if not, fragmentase time should be adjusted accordingly (more time = shorter library size). A suggested assay might include 3 preps of the same pool with: 1 minute, 3.5 minutes, and 5 minutes of fragmentation.
3c. Sequencing preparation. After libraries are complete, an agarose gel should be run to show successful amplification and product in the correct size range (300-500bp).
3d. Library quantification -- Qubit. Libraries should be analyzed using a Qubit to determine DNA concentration. If concentration is too low (< 1ng/ul), the library must be redone or reamplified. We used the KAPA HiFi HotStart Library Amplification Kit to reamplify low concentration libraries (protocol below).
3e. Pooling of the final sequencing library. Libraries should be pooled at equal molarity and run on a Bioanalyzer. The latter step is typically done by our staff at the WVU Genomics Core.
3f. Size selection should be conducted on a Blue Pippin Prep to select for library fragments between 300 and 500bp. Alternatively, you can size-select by gel cutting, or by bead cleanups with different bead:sample ratios.
3g. Sequencing. Sequences were run on Illumina HiSeq and MiSeq. The MiSeq at WVU is probably sufficient for a smaller number of samples (e.g. < 48 samples), but we would recommend HiSeq, NextSeq, or NovaSeq for more samples/primers used for amplicons, as this will provide higher coverage. As always, this is a tradeoff between sequencing depth and cost.
4. Detailed SparQ Fragmentase Protocol – ISSR Amplicons
Additional note: All reactions in protocol have been calculated to be 40% the recommended volume of original SparQ kit protocol (50 ul reduced to 20 ul)
Prior to starting the protocol:
4a. Perform bead cleanups on pooled PCR products, such that amplicons below ~100 bp are excluded. Quantify with a Qubit.
-
Equilibrate AMPure XP beads to room temperature -- ~ 20 minutes.
-
Vortex beads and add a 1:1 bead: sample ratio (1.0X) to each amplicon pool – pipette mix 5-10x. So for 10 ul of amplicon, add 10 ul beads, for 30 ul amplicon, add 30 ul beads.
-
Incubate at room temperature for 5-10 minutes.
-
Pellet beads using the magnetic plate, and discard supernatant.
-
Remove from magnetic plate.
-
Wash beads with 200 ul of fresh 80% ethanol.
-
Remove supernatant and repeat for a second wash with 80% ethanol.
-
Place on magnetic plate and allow beads to air-dry -- ~ 5-10 minutes.
-
Resuspend beads in 22 ul of TE buffer. Add TE and let sit for 2 minutes to soften pellets. Pipet-mix 5-10x.
-
Place on magnetic plate and transfer as much of the supernatant to tube for storage.
-
Samples can now be stored at -20C
4b. Qubit the cleaned sample pools using the HS dsDNA assay and Dilute sample pools to 5 ng/ul.
Library preps of ISSR amplicons
4c. Prepare a fresh 80% ethanol solution in a 50 ml tube; if you have a lot left over from recent ISSR amplicon cleanups, use that. The Adapter Ligation clean-up will require 400uL ethanol/sample (2x washes @ 200 ul/sample), and the Library Amplification clean-up requires 200uL ethanol/sample.
4d. Prepare a solution of 10 mM Tris-HCL @ pH 8.0.
4e. Clean your work area with 70% ethanol, diluted bleach (10%), or RNAse Zap/RNAaway (if you have it, but probably not necessary).
4f. Thaw reagents on ice – finger flick DNA Frag & Polishing Mix (DO NOT VORTEX ENZYMES!!!), DNA Ligase, and HiFi PCR Master Mix – others can be vortexed.
4g. Program thermocyclers with the programs listed below.
4h. Make a spreadsheet in excel with all samples, fragmentase time, and iTru barcodes. You MUST know which barcodes code for which sample. Cannot use the same pair of primers for different samples, each sample must have a unique primer pair for later identification.
DNA Fragmentation and Polishing
Thermocycler Program – lid at 70°C
| Step | Temperature | Time |
|---|---|---|
| 1 | 4°C | Initially paused, then 1 minute |
| 2 | 32°C | Varies (3.5 minutes for ISSR) |
| 3 | 65°C | 30 minutes |
| 4 | 4°C | Hold |
| Reagent | ul per reaction |
|---|---|
| DNA Frag & Polishing Buffer (10X) | 2 |
| DNA (pooled, cleaned PCR product @ 5ng/ul) | 8 |
| Nuclease-free H20 | 5 |
| DNA Frag Enhancer Solution | 1 |
| Total | 16 |
4i. Set thermocycler block to hold at 4°C.
4j. Set up master mixes on ice, without the DNA Frag and Polishing Enzyme.
4k. Label PCR tubes and add 4 ul of the DNA Frag and Polishing Enzyme to each.
4l. Add 20 ul of the master mix (including template DNA) to each tube – pipette-mix (5x). Keep plate on ice.
4m. Place each tube or the plate into the thermocycler.
4n. Resume the PCR program once all samples are loaded.
4o. Transfer tubes to ice at run completion.
4p. Proceed immediately to adapter ligation.
5. Adapter Ligation
Adapter ligation reaction mix
| Reagent | ul per reaction |
|---|---|
| DNA Rapid Ligation Buffer (5X) | 8 |
| DNA ligase | 4 |
| Nuclease-free H2O | 6 |
| Total | 18 |
Thermocycler Incubation Program – lid NOT heated
| Step | Temperature | Time |
|---|---|---|
| 1 | 20°C | 25 minutes |
5a. Transfer 2 ul of 15 uM core-supplied Y-adapter into each tube – pipette mix, and store on ice.
5b. Prepare ligation reaction mix – pipette mix and store on ice.
5c. Add 18 ul of ligation reaction mix to the fragmented DNA and adapter tube – pipette mix.
5d. Incubate at 20°C for 25 minutes – use a thermocycler with heated lid disabled.
5e. Proceed immediately to adapter ligation bead cleanup.
6. Adapter Ligation Cleanup
6a. Equilibrate Axygen beads to room temperature -- ~ 20 minutes.
6b. Vortex beads and add 32 ul to each ligation sample – pipette mix.
6c. Incubate at room temperature for 5 minutes.
6d. Pellet beads using the magnetic plate, and discard supernatant.
6e. Wash beads with 200 ul of fresh 80% ethanol. Remove ethanol after 30 sec, and repeat this step for a total of 2 washes.
6f. Allow beads to air-dry while on the plate -- ~ 5-10 minutes. Avoid overdrying, which will decrease yield.
6g. Remove from magnetic plate and resuspend beads in 9.2 ul of 10 mM Tris-HCL, pH 8.0. It helps to pipet up and down ~5-10x. Let stand at room temp 5 minutes.
6h. Place on magnetic plate and transfer 7.6 ul of supernatant to a thin-walled PCR tube. Samples can now be stored at -20°C.
Can stop at this point and resume later.
7. Library Amplification
Library Amplification Master Mix
| Reagent | ul per reaction (1x) |
|---|---|
| HiFi PCR Master Mix (2X) | 10 |
| Primer Mix | 1.5 ul each i5 & I7 (3 ul total, sample-specific dual barcodes) |
| Total | 13 |
Library amplification thermocycler program – set heated lid to 105°C.
| Step | Temperature | Time | Cycles |
|---|---|---|---|
| 1 | 98°C | 2 min | 1 |
| 2 | 98°C | 20 sec | |
| 3 | 60°C | 30 sec | varies, but usually 12 cycles |
| 4 | 72°C | 30 sec | |
| 5 | 72°C | 1 min | 1 |
| 6 | 4°C | Hold |
7a. Add 10 ul of the library amplification master mix to each tube – pipette mix and store on ice.
7b. Pulse-spin tubes and proceed immediately to amplification.
7c. After completion of the thermal cycle, proceed immediately to post-amplification cleanup.
8. Library Amplification Cleanup
8a. Equilibrate AMPure XP beads to room temperature -- ~ 20 minutes.
8b. Vortex beads and add 20 ul (1X) to each ligation sample – pipette mix.
8c. Incubate at room temperature for 5 minutes.
8d. Pellet beads using the magnetic plate, and discard supernatant.
8e. Remove from magnetic plate.
8f. Wash beads with 200 ul of fresh 80% ethanol.
8g. Place on magnetic plate and allow beads to air-dry -- ~ 5-10 minutes.
8h. Resuspend beads in 19.2 ul of 10 mM Tris-HCL, pH 8.0. If pellets are cracking, add Tris-HCL to dry pellets until all are dry. Add Tris-HCL and let sit for 2 minutes to soften pellets.
8i. Place on magnetic plate and transfer 17.6 ul of supernatant to tube for storage. Samples can now be stored at -20°C
8j. Run a 1% agarose gel for all libraries.
8k. Quantify with Qubit
9. KAPA HiFi HotStart Library Amplification Kit Protocol (optional, may be needed for only some samples)
This protocol is intended for library re-amplification if concentrations are too low, not for building libraries. Note the primer mix used in this protocol is the general primer mix from the SparQ protocol, not the barcoded primers used for building libraries.
9a. Set up the reactions.
Reaction mix (25 ul rxns):
| Volume | Reagent |
|---|---|
| 12.5 ul | KAPA Master Mix |
| 0.75 ul | primer mix (from SparQ kit) |
| 11.75 ul | Adapter Ligated DNA (Library)* |
*can use 5.875 ul of DNA and 5.875 ul of molecular water if library sample is small.
Thermocycler settings:
| Temperature | Time |
|---|---|
| 98C | 45 sec |
| 98C | 15 sec |
| 60C | 30 sec 10-18 cycles: |
| 72C | 30 sec |
| 72C | 1 min |
| 4C | Hold |
*10-18 cycles depending on your start concentration. For very low concentrations, increase the number of cycles.
9b. Run Nanodrop or Qubit (preferred) and a 1% agarose gel to check for successful amplification.
10. Final library pooling
10a. Pool all libraries at equimolar concentration
10b. Submit for QC and sequencing at the WVU Genomics Core. This involves a run on the Bioanalyzer to quantify fragment size and concentration. There may need to be some size selection. We can do all this for you at WVU!
10c. Send to the sequencer.