in silico assembly of pYPKa_A_ATF1 - MetabolicEngineeringGroupCBMA/MetabolicEngineeringGroupCBMA.github.io GitHub Wiki

The pYPKa_A_ATF1 is a cloning vector which has the ATF1 gene, but no promoter or terminator. It can only be maintained in E. coli. The purpose of this plasmid is to serve as template for a PCR reaction.

The plasmid is made by cloning the PCR product containing the AFT1 gene into the AjiI restriction site using DNA ligase ( figure ).

Use the following in order to assemble the sequence for the pYPKa_A_ATF1 plasmid:

The pYPKa.gb sequence file.
The sequence for the ATF1 gene.
The two primer sequences below (1795 & 1732), used to amplify the ATF1 gene.

>1795_ATF1f CP072089 1046219 1047796
gcaata ATG GGT AATGAAATCGATGAGAAAAATCA
	
>1732_ATF1r CP072089 1046219 1047796
TTAAGGGCCTAAAAGGA

Procedure:

Use the WebPCR tool to simulate the PCR product using the primer sequences and the ATF1 sequence from genbank:

in silico assembly of pYPKa_A_ATF1-20240709175312224.png

The resulting PCR product sequence should be around 1580-1590 bp long:

>ATF1_PCR_prod
gcaataATGGGTAATGAAATCGATGAGAAAAATCAGAA...GCTCTCCTTTTAGGCCCTTAA
---

Open the pYPKa sequence in ApE:

in silico assembly of pYPKa_A_ATF1-20240709173627486.png

Find the AjiI restriction site (CACGTC). The AjiI has the same properties as the enzymes BmgBI and BtrI. If AjiI is not available in the enzyme selection, they can be used instead. The AjiI restriction enzyme produces a blunt cut since both cut sites are in the same position (^ in the figure below).
```
  5'...GAC^GTG...3'
  3'...CTG^CAC...5'
```
Paste the PCR product sequence at the cut site of the pYPKa

in silico assembly of pYPKa_A_ATF1-20240709180601962.png

Calculate the size and seguid checksum here. The expected size is around 4.7 kb and the short seguid is cdseguid=EsiXAn
Compare your result with that of your colleagues.
Save the new sequence file on your computer under the name pYPKa_A_ATF1.gb.

You can continue to the assembly of the AFT1 TU-vector pTA1_TDH3_ATF1_PGI1.