genbank reference - MetabolicEngineeringGroupCBMA/MetabolicEngineeringGroupCBMA.github.io GitHub Wiki

This instruction shows the steps to obtain a Genbank reference for a sequence.

A prerequisite is of course that the sequence is already in the Genbank database.

It is good to have this reference to avoid copy-paste errors, since database sequences might be updated in the future.

We will use the sequence below as an example.

Copy the sequence to the clipboard and go to Genbank BLAST.

>unknown_sequence
TACTTAAGAGCTAAACGAAAAGATAAGTATCTCGCTCAACCTTTTAATTTTGCACAGTTGAATTCTCGTC
TGATACTTAAGAAAGTCATTGCCCACATATATAACAGTAGTAATAATGATAATGATAGCAATAGTTTTAA
GCTAGCTACTTAGTTGCATTTTTCAATAGTTTAGTAAAAAAAGTCACGCAATAAGCTCTCAAGAAGCCAC
TAATACCGTAATGATAGCAGTTTATTGTAGAAAAACCATGTTATTACCCTTCCCTTTTTATTTCTTTTCG
CGTTGCAAATCACATATAACGAGGTGGCTTGTATTTGTCAAACCAAAAAAAAAAATGAAAATCGAAAAAT
GGAAAAACAGAGAGAGAAACGGAATCTTTGACACGTTCTCGATCCACTTGTTTATCGAGGTGGTTTTTAT
AAGTCTTACTAGATAGAAAGTTCATTTTGTTTTGAAACTTTTTGGAACCTCTGGCATTGAAGGTATAAGA
AAGAACTCAAACAGGTTTAATAGAATTAAAA

Paste the sequence in the main text area and click the blue BLAST button to start the search.

Look at the first result, which is the one with the highest E-value. This result must have 100% "Query Cover" and 100% identity (Per. ident). If either of these are not 100%, the sequence you are searching for is not present in the database.

Click on the "Alignments" button.

Click on the "Genbank" button.

The genbank reference is the text after the "ACCESSION" keyword. Copy this and store for future reference.

This format "CP046084 REGION: 115662..116182" is compatible with later versions of ypkpathway and the genbank function in pydna