2x PCR mastermix - MetabolicEngineeringGroupCBMA/MetabolicEngineeringGroupCBMA.github.io GitHub Wiki

2x PCR mastermix

Using a PCR master-mix saves time and improves PCR reproducibility, especially if many reactions are prepared. For a standard PCR reaction, half of the final volume should be used, for example 25 µL 2x PCR mastermix for a 50 µL PCR reaction. Scale up or down as needed.

Component µL stock 2xPCR mastermix final concentration in PCR reaction
Water 16 - - -
Buffer(xC) 5 10x 2x 1x
MgCl2(mM) 2 50 mM 4 mM 2 mM
dNTPs(mM) 1 10 0.4 0.2
Taq 1 100% 5.0% 2.5%
Total 25 - - -

See standard pcr protocol.

1.5x Green PCR mastermix (mastermix with PCR compatible loading buffer)

The 2xPCR mastermix can be combined with a PCR compatible loading buffer such as the in described in the table below. This saves time if you have many samples as they can be loaded directly on a gel. Use 33 µL of the 1.5x Green PCR mastermix for a 50 µL PCR reaction. Scale up or down as needed.

Component µL
2x PCR mastermix 25
[[6 x DNA loading buffer (PCR compatible) 6x-DNA-loading-buffer]]
Total 33

For MEC lab members:

This google sheet contains the recipe above. Create a new tab named after the date of preparation in ISO 8601 format. Copy paste an old recipe and modify if necessary.

Testing

Since we make our own mastermix, we need a standardized test. We use the following mix:

  • 78 µL H2O
  • 10 µL Primer 19
  • 10 µL Primer 18
  • 2 µL Chromosomal DNA from yeast

The primers amplify a 1288 bp PCR product from the DFR1 locus in S. cerevisiae using this program consisting of initial denaturation for 4 min at 94 °C, followed by 30 cycles of 94 °C for 30s, 50 °C for 30s, and 72 °C for 45 s, and a final extension at 72 °C for 5 min. Source

| 94.0°C  |94.0°C                 |      |
|_________|_____          72.0°C  |72.0°C| 
| 04min00s|30s  \         ________|______| 
|         |      \ 50.0°C/ 0min45s| 5min | 
|         |       \_____/         |      | 
|         |         30s           |      |

This PCR reaction is very robust and gives a high yield.

Primers

  • 19_D-DFR1 GACTCAGACAGGTTGAAAAGAAGAC
  • 18_A-DFR1 CAAAGGTTTGGTTTTCAGTTAAGAA
⚠️ **GitHub.com Fallback** ⚠️