Upload to GenBank - linzhi2013/MitoZ GitHub Wiki

You need to find the following files for submitting mitogenomes to GenBank (https://www.ncbi.nlm.nih.gov/genbank/tbl2asn2/#Template):

  1. *_mitoscaf.fa.tbl

  2. *_mitoscaf.fa.gbf.fasta

If you have tried multiple assembly strategies, you should pick the *_mitoscaf.fa.tbl and *_mitoscaf.fa.gbf.fasta files from the same assembly strategy.

For example, I chose the two files:

sampleID_sampleID.mitoAssemble.K51.mitogenome.fa_mitoscaf.fa.gbf.fasta sampleID_sampleID.mitoAssemble.K51.mitogenome.fa_mitoscaf.fa.tbl

$ head sampleID_sampleID.mitoAssemble.K51.mitogenome.fa_mitoscaf.fa.tbl
>Feature C3892882
2742	3698	gene
			gene	ND1
2742	3698	CDS
			product	NADH dehydrogenase subunit 1
			transl_table	2
3905	4939	gene
			gene	ND2
3905	4939	CDS
			product	NADH dehydrogenase subunit 2
$ less sampleID_sampleID.mitoAssemble.K51.mitogenome.fa_mitoscaf.fa.gbf.fasta
>C3892882;len=16309
TTTTTTTTCCTTTGTTAATGTAGCTTATAGAAAGCAAAGCACTGAAA

However, *_mitoscaf.fa.tbl and *_mitoscaf.fa.gbf.fasta files must have the same sequence IDs, so we need to modify the sequence ID line of the *_mitoscaf.fa.gbf.fasta file a bit (via the vim command or any plain text editor, e.g. Notepad++ or Sublime text), changing it to:

$ less sampleID_sampleID.mitoAssemble.K51.mitogenome.fa_mitoscaf.fa.gbf.fasta
>C3892882 ;len=16309
TTTTTTTTCCTTTGTTAATGTAGCTTATAGAAAGCAAAGCACTGAAA

Note that now there is a space in the >C3892882 ;len=16309

Then go to https://submit.ncbi.nlm.nih.gov/about/bankit/ to submit your mitogenome.

If you want to use the 'sqn' file for submission, please refer to https://github.com/linzhi2013/MitoZ/issues/153.