cdskit pad

cdskit pad adds characters at the 5' and/or 3' end of nucleotide sequences to restore a length divisible by three. When more than one placement is possible, it chooses the placement with the fewest internal stop codons under the selected genetic code.

Example

Command

cdskit pad --seq_file input.fasta --out_file output.fasta

input.fasta

>miss_1nt_5prime
TGCTAAGCGGTAATCTAAGCGGTAATTGA
>miss_2nt_5prime
GCTAAGCGGTAATCTAAGCGGTAATTGA
>miss_1nt_3prime
ATGCTAAGCGGTAATCTAAGCGGTAATTG
>miss_2nt_3prime
ATGCTAAGCGGTAATCTAAGCGGTAATT
>miss_1nt_both
TGCTAAGCGGTAATCTAAGCGGTAATTG
>miss_2nt_both
GCTAAGCGGTAATCTAAGCGGTAATT
>complete
ATGCTAAGCGGTAATCTAAGCGGTAATTGA

output.fasta

>miss_1nt_5prime
NTGCTAAGCGGTAATCTAAGCGGTAATTGA
>miss_2nt_5prime
NNGCTAAGCGGTAATCTAAGCGGTAATTGA
>miss_1nt_3prime
ATGCTAAGCGGTAATCTAAGCGGTAATTGN
>miss_2nt_3prime
ATGCTAAGCGGTAATCTAAGCGGTAATTNN
>miss_1nt_both
NTGCTAAGCGGTAATCTAAGCGGTAATTGN
>miss_2nt_both
NNGCTAAGCGGTAATCTAAGCGGTAATTNN
>complete
ATGCTAAGCGGTAATCTAAGCGGTAATTGA

Key options

• --pad_char CHAR sets the padding character (N by default).
• --codon_table INT selects the genetic code used to count internal stops.
• --drop_pseudo yes omits sequences that still contain internal stop codons after the best padding is chosen. The default is no.

The command writes the selected head/tail padding and stop counts to standard error for records that require evaluation.

Frame preservation and provenance

--mode min-stop (default) retains the historical candidate order and picks the first candidate with the fewest definite internal stops. Alternative frames are evaluated only when the initially tail-padded sequence has such a stop. Otherwise, the original sequence or its tail-padded form is retained. Equal scores do not establish a unique biological frame.

Use --mode preserve-frame for a supplied/annotated reading frame. It only adds 0–2 characters at the tail, preserving the original bases (including X and letter case); internal stops remain visible. --drop_internal_stop yes drops records with definite internal stops after the selected padding; --drop_pseudo yes is a compatibility alias. Neither option diagnoses a pseudogene, and retained records can still contain uncertain stop possibilities.

cdskit pad --seq_file cds.fasta --out_file padded.fasta \
  --mode preserve-frame --drop_internal_stop yes --report padding.json

The optional report includes original and initially tail-padded counts, every evaluated placement, head/tail padding, frame offset in the original sequence, selected and tied candidate indexes, and the keep/drop reason. The stderr field tail_padded_num_stop replaces the misleading original_num_stop label. An original frame offset is zero-based; it is (-head_padding) mod 3 after padding. Artificial padding is not recovered sequence evidence.

For example, default padding can turn ATGTAAGGG into NATGTAAGGGNN with zero internal stops. This does not demonstrate that the new frame is correct. Internal frameshifts cannot in general be repaired by changing only the ends. See codon meaning and uncertainty for terminal rules, report formats and interpretation.

References

Cite the method or resource actually used and report the CDSKIT version and options.

• Fukushima K, Pollock DD (2023). Detecting macroevolutionary genotype–phenotype associations using error-corrected rates of protein convergence. Nature Ecology & Evolution 7:155–170. Paper — Published CDSKIT workflow context; describes pad, mask, backtrim and hammer, not all later options.