PolyMarker for KASP markers

To run PolyMarker with the CSS wheat contigs, you need to unzip the reference file from ensembl.

polymarker.rb --contigs Triticum_aestivum.IWGSC2.25.dna.genome.fa --marker_list snp_list.csv --output output_folder

The snp_list file must follow the convention ID,Chromosome,SEQUENCE with the SNP inside the sequence in the format [A/T]. As a reference, look at test/data/short_primer_design_test.csv

If you want to use the web interface, visit the PolyMarker webservice at TGAC

The available command line arguments are:

polymarker.rb --help

Usage: polymarker.rb [options]
    -c, --contigs FILE               File with contigs to use as database
    -m, --marker_list FILE           File with the list of markers to search from
    -g, --genomes_count INT          Number of genomes (default 3, for hexaploid)
    -s, --snp_list FILE              File with the list of snps to search from, requires --reference to get the sequence using a position
    -t, --mutant_list FILE           File with the list of positions with mutation and the mutation line.
    requires --reference to get the sequence using a position
    -r, --reference FILE             Fasta file with the sequence for the markers (to complement --snp_list)
    -o, --output FOLDER              Output folder
    -e, --exonerate_model MODEL      Model to be used in exonerate to search for the contigs
    -i, --min_identity INT           Minimum identity to consider a hit (default 90)
    -a, --arm_selection arm_selection_embl|arm_selection_morex|arm_selection_first_two
                    Function to decide the chromome arm
    -p, --primer_3_preferences FILE  file with preferences to be sent to primer3
    -v, --variation_free_region INT  If present, avoid generating the common primer if there are homoeologous SNPs within the specified distance (not tested)
    -x, --extract_found_contigs      If present, save in a separate file the contigs with matches. Useful to debug.
    -P, --primers_to_order			 If present, saves a file named primers_to_order which contains the KASP tails

Preparing the reference

Before running PolyMarker you have to prepare the reference. The FASTA file has to be uncompressed and you need to index it with samtools and make a the blast database with the following commands:

samtools faidx reference.fasta
makeblastdb -dbtype nucl -in reference.fasta

Input formats

The following formats are used to define the marker sequences:

Marker list

If the option --marker_list FILE is used, the SNP and the flanking sequence is included in the file. The format contains 3 columns (the order is important):

• snp_name The ID of the marker. Must be unique.
• target chromosome for the specific primers. Must be in line with the chromosome selection critieria.
• sequence The sequence flanking the SNP with the SNP highligted on square brackets ([]) and the two alleles separated by a forward slash (/).

Example:

BS00068396_51,2A,CGAAGCGATCCTACTACATTGCGTTCCTTTCCCACTCCCAGGTCCCCCTA[T/C]ATGCAGGATCTTGATTAGTCGTGTGAACAACTGAAATTTGAGCGCCACAA

SNP list

If the flanking sequence is unknow, but the position on a reference is available, the option --snp_list can be used and the FASTA file with the reference sequence must be provided with the option --reference. This is to allow the use of a different assembly or set of contigs used for the discovery of the SNPs that are different to the reference given in the option --contigs. The format contains the following positional columns:

• scaffold The sacffold where the SNP is.
• reference allele The base in the reference (may or may not be the same as in the reference file.
• position Position of the SNP. The first base in the scaffold is base 1.
• alternative allele The base in the alternative allele.
• target chromosome for the specific primers. Must be in line with the chromosome selection critieria.

Example

IWGSC_CSS_1AL_scaff_110,C,519,A,2A

This file format can be used with snp_positions_to_polymarker.rb to produce the input for the option--marker_list.

Custom reference sequences.

By default, the contigs and pseudomolecules from ensembl are used. However, it is possible to use a custom reference. To define the chromosome where each contig belongs the argument arm_selection is used. The defailt uses ids like: IWGSC_CSS_1AL_scaff_110, where the third field, separated by underscores is used. A simple way to add costum references is to rename the fasta file to follow that convention. Another way is to use the option --arm_selection arm_selection_first_two, where only the first two characters in each contig is used as identifier, useful when pseudomolecules are named after the chromosomes (ie: ">1A" in the fasta file).

If your contigs follow a different convention, in the file ChromosomeArm.rb it is possible to define new parsers, by adding at the begining, with the rest of the parsers a new lambda like:

@@arm_selection_functions[:embl] = lambda do | contig_name|
  arr = contig_name.split('_')
  ret = "U"
  ret = arr[2][0,2] if arr.size >= 3
  ret = "3B" if arr.size == 2 and arr[0] == "v443"
  ret = arr[0][0,2] if arr.size == 1   
  return ret
end

The function should return a 2 character string, when the first is the chromosome number and the second the chromosome group. The symbol in the hash is the name to be used in the argument --arm_selection. If you want your parser to be added to the distribution, feel free to fork and make a pull request.

Using blast

To use blast instead of exonerate, use the following command:

./bin/polymarker.rb --contigs test/data/BS00068396_51_contigs.fa --marker_list test/data/BS00068396_51_for_polymarker.fa  --aligner blast  -a arm_selection_first_two

Custom Primer3 options

By default, PolyMarker uses a sensible set of defaults to design KASP marker in Primer3. However, you can tune to different options described in the Primer3 documentation.