Task: refquery - sanger-pathogens/ariba Wiki

Task: refquery

This looks up information about a sequence or a cluster, using the output from prepareref. It can:

  1. Given a cluster name, return the names of all the sequences in that cluster.

  2. Given a sequence name, return all the metadata for that sequence, plus the nucleotide sequence.

Examples

Suppose we have prepared the data from CARD using the following two commands:

ariba getref card getref

ariba prepareref -f getref.fa -m getref.tsv ref_dir

Get sequences from a cluster

To find all the sequences in cluster "ErmD":

ariba refquery ref_dir cluster ErmD

which outputs:

Sequences belonging to cluster ErmD:
ErmD.3000495.L08389.390-1254.240
ErmD.3000495.M29832.0-864.242
ErmD.3000495.M77505.771-1635.241

### Get sequence information

To get the information about the sequence "ErmD.3000495.L08389.390-1254.240":

ariba refquery ref_dir seq ErmD.3000495.L08389.390-1254.240

which outputs:

Name            ErmD.3000495.L08389.390-1254.240
Is gene         1
Variant only    0
Cluster         ErmD
Description     ErmD confers MLSb phenotype.
Description     ErmD
Sequence        ATGAAGAAAAAAAATCATAAGTACAGAGGAAAAAAGTTAAACCGCGGGGAATCTCCGAATTTTTCCGGACAGCATTTGATGCATAATAAAAAATTAATTGAAGAAATTGTGGATCGGGCAAATATTAGCATAGACGATACGGTTTTAGAGTTAGGAGCGGGAAAAGGGGCTTTGACAACTGTGCTAAGTCAAAAAGCCGGTAAGGTATTGGCAGTGGAAAACGATTCTAAATTCGTTGATATACTCACACGTAAAACAGCACAGCATTCAAATACGAAAATTATTCATCAAGATATCATGAAGATTCATTTACCAAAAGAAAAGTTTGTGGTGGTCTCTAATATTCCCTATGCCATCACAACTCCCATCATGAAAATGCTCTTGAACAATCCTGCAAGCGGATTTCAAAAAGGGATCATCGTAATGGAAAAAGGGGCTGCTAAACGTTTCACATCAAAATTCATTAAAAATTCCTATGTTTTAGCTTGGAGAATGTGGTTTGATATTGGCATTGTCAGAGAAATATCGAAAGAGCATTTTTCTCCCCCTCCAAAAGTGGACTCGGCAATGGTCAGAATAACACGAAAAAAAGACGCGCCTCTATCACATAAACATTATATTGCGTTTCGGGGACTTGCCGAATACGCGCTAAAGGAGCCGAATATCCCTCTCTGTGTTCGTTTACGCGGAATTTTTACCCCGCGTCAAATGAAACACTTAAGAAAAAGTCTAAAAATCAACAATGAAAAAACCGTTGGAACGCTCACCGAAAACCAATGGGCGGTTATTTTTAACACGATGACTCAATATGTAATGCATCACAAATGGCCAAGAGCAAATAAGCGAAAACCCGGAGAAATATAA
⚠️ **GitHub.com Fallback** ⚠️